Update Cell Line “AICS-88-83/index”

src/pages/cell-line/AICS-88-83/index.md

@@ -2,7 +2,7 @@
 templateKey: cell-line
 cell_line_id: 88
 status: data complete
-date: 2025-05-06T22:17:55.522Z
+date: 2026-07-30T22:40:00.000Z
 clone_number: 83
 parental_line: 0
 genetic_modifications:
@@ -13,13 +13,17 @@ genetic_modifications:
 order_link: https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=AICS-0088-083&PgId=166
 certificate_of_analysis: https://www.coriell.org/0/PDF/Allen/ipsc/AICS-0088-083_CofA.pdf
 donor_plasmid: https://www.addgene.org/170818/
-hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-56
 images_and_videos:
   images:
     - image: single_plane_image_cl83.jpg
-      caption: "Single, mid-level plane of cells in a live hiPS cell colony expressing mEGFP-tagged proliferating cell nuclear antigen (PCNA). Cells were imaged in 3D on a spinning-disk confocal microscope. Scale bar, 5µm."
+      caption: Single, mid-level plane of cells in a live hiPS cell colony expressing
+        mEGFP-tagged proliferating cell nuclear antigen (PCNA). Cells were
+        imaged in 3D on a spinning-disk confocal microscope. Scale bar, 5µm.
     - image: Main_cell_line_morphology.jpg
-      caption: "Viability and colony formation one day and three days post-thaw. Cells were treated with ROCK inhibitor for 24 hrs post-thaw."
+      caption: Viability and colony formation one day and three days post-thaw. Cells
+        were treated with ROCK inhibitor for 24 hrs post-thaw.
+    - image: ReleaseWestern_AICS-0088_PCNA-mEGFP.jpg
+    - image: ReleaseIF_AICS-0088_PCNA-mEGFP.jpg
   videos:
     - caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged
         proliferating cell nuclear antigen (PCNA). A single, mid-level plane of
@@ -38,72 +42,93 @@ images_and_videos:
       video: https://player.vimeo.com/video/1079876541
 editing_design:
   ncbi_isoforms:
-    - 
+    - null
   cr_rna: GTTCGAGGCGCGCCTGGTCC
   linker: GEGQGQGQGPGRGYAYRS
   cas9: Wildtype spCas9
   diagrams:
-    - title: "mEGFP Insert"
+    - title: mEGFP Insert
       images:
         - image: EditingDesign_gene_figure.png
-          caption: "Top: PCNA locus showing 2 PCNA isoforms; Bottom: Zoom in on mEGFP insertion site at PCNA N-terminal exon"
-category_labels: 
- - Nuclear Structure
+          caption: "Top: PCNA locus showing 2 PCNA isoforms; Bottom: Zoom in on mEGFP
+            insertion site at PCNA N-terminal exon"
 genomic_characterization:
   diagrams:
-    - title: "Schematic of Junctions"
+    - title: Schematic of Junctions
       images:
         - image: /img/shared/GenomicCharacterization_junction_schematic_mEGFP.png
   amplified_junctions:
     - edited_gene: ""
-      junction: "5'"
+      junction: 5'
       expected_size: ""
       confirmed_sequence: ""
     - edited_gene: ""
-      junction: "3'"
+      junction: 3'
       expected_size: ""
       confirmed_sequence: ""
     - edited_gene: ""
-      junction: "WT"
+      junction: WT
       expected_size: ""
       confirmed_sequence: ""
     - edited_gene: ""
-      junction: "Full junctional allele"
+      junction: Full junctional allele
       expected_size: "Tagged: bp; Untagged: bp"
       confirmed_sequence: ""
-  junction_table_caption: "PCR amplified 5', 3', WT, and full allele junctions. 5', 3', and WT junctions were Sanger sequenced to check for precise mEGFP insertion. Primers were designed to exclude amplification from the donor plasmid."
+  junction_table_caption: PCR amplified 5', 3', WT, and full allele junctions. 5',
+    3', and WT junctions were Sanger sequenced to check for precise mEGFP
+    insertion. Primers were designed to exclude amplification from the donor
+    plasmid.
   ddpcr:
     - tag: PCNA-mEGFP
       clone: 83
-      fp_ratio: 
-      plasmid: 
-  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: KAN/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no detectable plasmid integration. RPP30 is known 2n reference gene."
+      fp_ratio: null
+      plasmid: null
+  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate
+    heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid:
+    KAN/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no
+    detectable plasmid integration. RPP30 is known 2n reference gene."
+category_labels:
+  - Nuclear Structure
+hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-56
 stem_cell_characteristics:
   pluripotency_analysis:
-    - marker: "NANOG"
-      positive_cells: 
-    - marker: "SOX2"
-      positive_cells: 
-    - marker: "OCT4"
-      positive_cells: 
-    - marker: "SSEA-1"
-      positive_cells: 
-    - marker: "SSEA-4"
-      positive_cells: 
-    - marker: "TRA-160"
-      positive_cells: 
-  pluripotency_caption: "iPSCs were stained with directly conjugated antibodies from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, then marker-specific gates were set according to corresponding fluorescence-minus-one (FMO) controls."
+    - marker: NANOG
+      positive_cells: null
+    - marker: SOX2
+      positive_cells: null
+    - marker: OCT4
+      positive_cells: null
+    - marker: SSEA-1
+      positive_cells: null
+    - marker: SSEA-4
+      positive_cells: null
+    - marker: TRA-160
+      positive_cells: null
+  pluripotency_caption: iPSCs were stained with directly conjugated antibodies
+    from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences),
+    and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded,
+    then marker-specific gates were set according to corresponding
+    fluorescence-minus-one (FMO) controls.
   trilineage_differentiation:
-    - germ_layer: "Ectoderm"
-      marker: "PAX6"
-      percent_positive_cells: 
-    - germ_layer: "Endoderm"
-      marker: "SOX17"
-      percent_positive_cells: 
-    - germ_layer: "Mesoderm"
-      marker: "Brachyury"
-      percent_positive_cells: 
-  trilineage_caption: "iPSCs were subjected to a 5-7 day, non-terminal, directed differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL Technologies, Inc.). Total RNA was isolated from each lineage specific differentiation and assayed via ddPCR for the expression of lineage specific transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm)."
-  cardiomyocyte_differentiation:
-  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to cardiomyocytes and observed for initiation of beating starting at day 6. At ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD Biosciences) and gating was based on an isotype control. Ranges observed across multiple experiments are shown for Troponin T and Day of beating initiation; number of experiments is shown in (). "
----
+    - germ_layer: Ectoderm
+      marker: PAX6
+      percent_positive_cells: null
+    - germ_layer: Endoderm
+      marker: SOX17
+      percent_positive_cells: null
+    - germ_layer: Mesoderm
+      marker: Brachyury
+      percent_positive_cells: null
+  trilineage_caption: iPSCs were subjected to a 5-7 day, non-terminal, directed
+    differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL
+    Technologies, Inc.). Total RNA was isolated from each lineage specific
+    differentiation and assayed via ddPCR for the expression of lineage specific
+    transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm).
+  cardiomyocyte_differentiation: null
+  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to
+    cardiomyocytes and observed for initiation of beating starting at day 6. At
+    ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD
+    Biosciences) and gating was based on an isotype control. Ranges observed
+    across multiple experiments are shown for Troponin T and Day of beating
+    initiation; number of experiments is shown in (). "
+---