Update Cell Line “AICS-93-25/index”

src/pages/cell-line/AICS-93-25/index.md

@@ -13,13 +13,17 @@ genetic_modifications:
 order_link: https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=AICS-0093-025&PgId=166
 certificate_of_analysis: https://www.coriell.org/0/PDF/Allen/ipsc/AICS-0093-025_CofA.pdf
 donor_plasmid: https://www.addgene.org/168798/
-hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-48
 images_and_videos:
   images:
     - image: single_plane_image_cl25.jpg
-      caption: "Single, mid-level plane of cells in a live hiPS cell colony expressing mEGFP-tagged telomeric repeat-binding factor 2 (TRF2). Cells were imaged in 3D on a spinning-disk confocal microscope. Scale bar, 5 μm."
+      caption: Single, mid-level plane of cells in a live hiPS cell colony expressing
+        mEGFP-tagged telomeric repeat-binding factor 2 (TRF2). Cells were imaged
+        in 3D on a spinning-disk confocal microscope. Scale bar, 5 μm.
     - image: Main_cell_line_morphology.jpg
-      caption: "Viability and colony formation one day and three days post-thaw. Cells were treated with ROCK inhibitor for 24 hrs post-thaw."
+      caption: Viability and colony formation one day and three days post-thaw. Cells
+        were treated with ROCK inhibitor for 24 hrs post-thaw.
+    - image: ReleaseWestern_AICS0093_TRF2-mEGFP.jpg
+    - image: ReleaseIF_AICS0093_TRF2-mEGFP.jpg
   videos:
     - caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged
         TERF2. A single, mid-level plane of the cells was imaged every 3 min on
@@ -37,79 +41,101 @@ images_and_videos:
       video: https://player.vimeo.com/video/1079598064
 editing_design:
   ncbi_isoforms:
-    - 
+    - null
   cr_rna: CGCTGTTTCTATCATGGCCG
   linker: SGRTQIP
   cas9: Wildtype spCas9
   diagrams:
-    - title: "mEGFP Insert"
+    - title: mEGFP Insert
       images:
         - image: EditingDesign_gene_figure.png
-          caption: "Top: TERF2 locus; Bottom: Zoom in on mEGFP insertion site at TERF2 N-terminal exon."
-category_labels: 
- - Nuclear Structure
+          caption: "Top: TERF2 locus; Bottom: Zoom in on mEGFP insertion site at TERF2
+            N-terminal exon."
 genomic_characterization:
   diagrams:
-    - title: "Schematic of Junctions"
+    - title: Schematic of Junctions
       images:
         - image: /img/shared/GenomicCharacterization_junction_schematic_mEGFP.png
-    - title: "Karyotype Analysis"
+    - title: Karyotype Analysis
       images:
         - image: AICS-93_cl25_TERF2_karyotype.JPG
-          caption: "After cells banks were created, one vial was thawed and 30 G-banded metaphase cells were karyotyped."
+          caption: After cells banks were created, one vial was thawed and 30 G-banded
+            metaphase cells were karyotyped.
   amplified_junctions:
-    - edited_gene: "TERF2-mEGFP"
-      junction: "5'"
+    - edited_gene: TERF2-mEGFP
+      junction: 5'
       expected_size: "1712"
-      confirmed_sequence: "Yes"
-    - edited_gene: "TERF2-mEGFP"
-      junction: "3'"
+      confirmed_sequence: Yes
+    - edited_gene: TERF2-mEGFP
+      junction: 3'
       expected_size: "1652"
-      confirmed_sequence: "Yes"
-    - edited_gene: "TERF2-mEGFP"
-      junction: "WT"
+      confirmed_sequence: Yes
+    - edited_gene: TERF2-mEGFP
+      junction: WT
       expected_size: "1637"
-      confirmed_sequence: "Yes"
-    - edited_gene: "TERF2-mEGFP"
-      junction: "Full junctional allele"
+      confirmed_sequence: Yes
+    - edited_gene: TERF2-mEGFP
+      junction: Full junctional allele
       expected_size: "Tagged: bp; Untagged: bp"
-      confirmed_sequence: "Yes"
-  junction_table_caption: "PCR amplified 5', 3', WT, and full allele junctions. 5', 3', and WT junctions were Sanger sequenced to check for precise mEGFP insertion. Primers were designed to exclude amplif      ication from the donor plasmid."
+      confirmed_sequence: Yes
+  junction_table_caption: PCR amplified 5', 3', WT, and full allele junctions. 5',
+    3', and WT junctions were Sanger sequenced to check for precise mEGFP
+    insertion. Primers were designed to exclude amplif      ication from the
+    donor plasmid.
   ddpcr:
     - tag: TERF2-mEGFP
       clone: 25
       fp_ratio: 0.521
       plasmid: 0.008
-  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: KAN/RPP30 ratio from ddPCR assay; values <0.1 in      dicate clone with no detectable plasmid integration. RPP30 is known 2n reference gene."
+  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate
+    heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid:
+    KAN/RPP30 ratio from ddPCR assay; values <0.1 in      dicate clone with no
+    detectable plasmid integration. RPP30 is known 2n reference gene."
+category_labels:
+  - Nuclear Structure
+hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-48
 stem_cell_characteristics:
   pluripotency_analysis:
-    - marker: "NANOG"
+    - marker: NANOG
       positive_cells: 99.95
-    - marker: "SOX2"
+    - marker: SOX2
       positive_cells: 99.99
-    - marker: "OCT4"
+    - marker: OCT4
       positive_cells: 99.95
-    - marker: "SSEA-1"
+    - marker: SSEA-1
       positive_cells: 1.83
-    - marker: "SSEA-4"
+    - marker: SSEA-4
       positive_cells: 100
-    - marker: "TRA-160"
+    - marker: TRA-160
       positive_cells: 99.92
-  pluripotency_caption: "iPSCs were stained with directly conjugated antibodies from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, then marker-specific gates were set according to corresponding fluorescence-minus-one (FMO) controls."
+  pluripotency_caption: iPSCs were stained with directly conjugated antibodies
+    from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences),
+    and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded,
+    then marker-specific gates were set according to corresponding
+    fluorescence-minus-one (FMO) controls.
   trilineage_differentiation:
-    - germ_layer: "Ectoderm"
-      marker: "PAX6"
+    - germ_layer: Ectoderm
+      marker: PAX6
       percent_positive_cells: Pass
-    - germ_layer: "Endoderm"
-      marker: "SOX17"
+    - germ_layer: Endoderm
+      marker: SOX17
       percent_positive_cells: Pass
-    - germ_layer: "Mesoderm"
-      marker: "Brachyury"
+    - germ_layer: Mesoderm
+      marker: Brachyury
       percent_positive_cells: Pass
-  trilineage_caption: "iPSCs were subjected to a 5-7 day, non-terminal, directed differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL Technologies, Inc.). Total RNA was isolated from each lineage specific differentiation and assayed via ddPCR for the expression of lineage specific transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm)."
+  trilineage_caption: iPSCs were subjected to a 5-7 day, non-terminal, directed
+    differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL
+    Technologies, Inc.). Total RNA was isolated from each lineage specific
+    differentiation and assayed via ddPCR for the expression of lineage specific
+    transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm).
   cardiomyocyte_differentiation:
-    troponin_percent_positive: "81.5 (3)"
-    day_of_beating_percent: "100 (4)"
-    day_of_beating_range: "d10-d12"
-  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to cardiomyocytes and observed for initiation of beating starting at day 6. At ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD Biosciences) and gating was based on an isotype control. Ranges observed across multiple experiments are shown for Troponin T and Day of beating initiation; number of experiments is shown in (). "
----
+    troponin_percent_positive: 81.5 (3)
+    day_of_beating_percent: 100 (4)
+    day_of_beating_range: d10-d12
+  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to
+    cardiomyocytes and observed for initiation of beating starting at day 6. At
+    ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD
+    Biosciences) and gating was based on an isotype control. Ranges observed
+    across multiple experiments are shown for Troponin T and Day of beating
+    initiation; number of experiments is shown in (). "
+---